|
OriGene
ggtccaagtgatgctcaatggg Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/Cd38+Mouse+qPCR+Primer+Pair/pm42244013-162-8-13 Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Charles River Laboratories
resource source identifier krasla2 mice charles river n a oligonucleotides human irg1 sirna Resource Source Identifier Krasla2 Mice Charles River N A Oligonucleotides Human Irg1 Sirna, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/5+charles+helper+helper+identifier+kan+kan+laboratory+paav+paav+paav2+prg+resource+rg+river+source/pm42235511-258-2-7 Average 86 stars, based on 1 article reviews
resource source identifier krasla2 mice charles river n a oligonucleotides human irg1 sirna - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
OriGene
gaatgccaccttcatccgagaag reverse Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/Ptgs1+Mouse+qPCR+Primer+Pair/pm42234557-282-119-122 Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
gcgacatactcaagcaggagca reverse Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/Ptgs2+Mouse+qPCR+Primer+Pair/pm42234557-282-130-133 Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
tcgcctccaactcaagctggtt reverse Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/Ptgds+Mouse+qPCR+Primer+Pair/pm42234557-282-97-100 Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 Gtcttgagtccagatttgcagcc Origene Mp211819 Primers For Cox1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/Ptges+Mouse+qPCR+Primer+Pair/pm42234557-282-110-111 Average 94 stars, based on 1 article reviews
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Sangon Biotech
mouse fos qpcr primer pair Mouse Fos Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-8-36 Average 86 stars, based on 1 article reviews
mouse fos qpcr primer pair - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
mouse klf6 qpcr primer pair Mouse Klf6 Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-16-36 Average 86 stars, based on 1 article reviews
mouse klf6 qpcr primer pair - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
mouse jun qpcr primer pair Mouse Jun Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-0-36 Average 86 stars, based on 1 article reviews
mouse jun qpcr primer pair - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
mouse actb qpcr primer pair Mouse Actb Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-25-36 Average 86 stars, based on 1 article reviews
mouse actb qpcr primer pair - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |