Review





Similar Products

94
OriGene ggtccaagtgatgctcaatggg
Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/Cd38+Mouse+qPCR+Primer+Pair/pm42244013-162-8-13
Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Charles River Laboratories resource source identifier krasla2 mice charles river n a oligonucleotides human irg1 sirna
Resource Source Identifier Krasla2 Mice Charles River N A Oligonucleotides Human Irg1 Sirna, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/5+charles+helper+helper+identifier+kan+kan+laboratory+paav+paav+paav2+prg+resource+rg+river+source/pm42235511-258-2-7
Average 86 stars, based on 1 article reviews
resource source identifier krasla2 mice charles river n a oligonucleotides human irg1 sirna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene gaatgccaccttcatccgagaag reverse
Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/Ptgs1+Mouse+qPCR+Primer+Pair/pm42234557-282-119-122
Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene gcgacatactcaagcaggagca reverse
Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/Ptgs2+Mouse+qPCR+Primer+Pair/pm42234557-282-130-133
Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene tcgcctccaactcaagctggtt reverse
Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/Ptgds+Mouse+qPCR+Primer+Pair/pm42234557-282-97-100
Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene gtcttgagtccagatttgcagcc origene mp211819 primers for cox1
Gtcttgagtccagatttgcagcc Origene Mp211819 Primers For Cox1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/Ptges+Mouse+qPCR+Primer+Pair/pm42234557-282-110-111
Average 94 stars, based on 1 article reviews
gtcttgagtccagatttgcagcc origene mp211819 primers for cox1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Sangon Biotech mouse fos qpcr primer pair
Mouse Fos Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-8-36
Average 86 stars, based on 1 article reviews
mouse fos qpcr primer pair - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech mouse klf6 qpcr primer pair
Mouse Klf6 Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-16-36
Average 86 stars, based on 1 article reviews
mouse klf6 qpcr primer pair - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech mouse jun qpcr primer pair
Mouse Jun Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-0-36
Average 86 stars, based on 1 article reviews
mouse jun qpcr primer pair - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech mouse actb qpcr primer pair
Mouse Actb Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+primers/database+primer+qpcr+qprimerdb/pm42082500-224-25-36
Average 86 stars, based on 1 article reviews
mouse actb qpcr primer pair - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results